Glossary:
[-A-]
Allele - A given form of a gene that occupies a specific position or locus on a chromosome. Variant forms of genes occurring at the same locus are said to be alleles of one another.
Amplicon- Amplified DNA product derived from PCR.
Allele-Alternative form of a gene.
Autosome- chromosome other than a sex chromosome.
[-B-]
Base sequence - the order of bases in DNA.
Bayesian approaches to phylogenetic or population genetic inference. See Lewis and Swofford (2001) and pp. 100-102 of Hall (2001) for phylogenies, and Pritchard et al. (2001) for a population approach.
Bottleneck-: Reduction in population size that can have major influence on genetic variation because of the relationship between genetic drift and population size.
Bootstrapping- A statistical technique, used increasingly frequently in population genetic and phylogenetic analyses. The basic idea is that by repeated sampling (with replacement) from an original sample, one can use the variance among a large number of pseudoreplicates (often 2000 to 5000) to estimate variances and infer confidence intervals). Each pseudoreplicate consists of a sample of size N, equal to the original sample size, drawn randomly and with replacement
[-C-]
Chromosome - a long coiled strand in the nucleus, made up of DNA and protein. There are 46 human chromosomes, each containing DNA for hundreds or thousands of individual genes
Clone - a genetic duplicate.
Cloning - the process of producing a genetically identical group of cells from a single ancestor.
Codominant - two genes that are neither dominant or recessive; neither masks the other, as in the case of red geraniums crossed with white geraniums yielding pink geraniums.
Codon - a special code to make amino acid; a sequence of three nucleotides.
Complementary DNA (cDNA) - a single strand of DNA made in the lab to complement the bases in a strand of messenger RNA.
Conserved DNA sequences - sequences that have not changed over time.
Controlled breeding - the reproduction of desired characteristics.
Crossing-over/recombination - a process of chromsome exchange during cell division, resulting in new combinations of alleles.
Coalescence- Looking backward at allelic diversity, one infers a coalescence at the common ancestor. Coalescence theory is important in many areas of population genetics including inferences about effective population size, allele frequencies, selection intensity, mutation rate, and time since common ancestry of alleles.
[-D-]
Dihybrid cross - the graphing of two or more traits in a Punnett Square to predict heredity.
Diploid - a cell or organism that has two complete sets of chromosomes, as opposed to haploid, or those with only one member of each pair of the same chromosomes.
DNA (deoxyribonucleic acid) - a large double-stranded, spiraling molecule that contains genetic instructions for growth, development and replication. It is organized into bodies called chromosomes and found in the cell nucleus.
DNA fingerprinting - the use of fragments of DNA to identify the unique genetic makeup of an individual. There are the RFLP method and the PCR method.
DNA replication - the process or copying a DNA molecule just before cell division.
DNA sequencing - the process of determining the order of bases in a segment of DNA.
Dominant gene - a gene which passes on a certain physical characteristic, dominating over a recessive gene present on another chromosome.
Double helix - a common name for DNA, referring to the double-stranded, spiraling structure of the molecule.
Diploid- Having a double complement of chromosomes (generally a paternal and a maternal set).
[-E-]
Eukaryotes - all living things whose cells have nuclei (most living things).
Evolutionary forces- Five major forces can cause evolutionary change:
Natural selection
Genetic drift
Mutation
Non-random mating
Migration (in the genetic sense of permanent movement of genes from one location
to another)
The presence of any of these forces can generate gene frequency changes and violates assumptions of the Hardy-Weinberg Equilibrium (HWE).
[-F-]
Fitness- Easiest to encapsulate in its population genetics sense as the relative rate of increase of a genotype under viability selection alone
F-Statistics-Measure of correlation of alleles within individual and are related to inbreeding coefficient.F-statistics: a measure of genetic structure developed by Sewall Wright (1969, 1978). Statistically related to ANOVA
[-G-]
Gene - the unit of heredity in chromosomes; a segment of double-stranded DNA.
Gene cloning - the process of separating a gene and making identical copies of it.
Gene expression - the way information in a gene is changed to a protein or RNA. The DNA sequence is changed into RNA and usually (not always) then changed into protein.
Gene linkage map - a map of relative positions of genes on a chromosome. Genes inherited together are close to each other on the chromosome, and said to be linked. (see gene mapping)
Gene locus - the position a gene occupies on a chromosome.
Gene mapping - the process of determining the relative positions of genes on a DNA molecule. (see gene linkage map)
Gene pool - the genetic make-up of a specific population.
Gene silencing - the process of inactivating a gene that may cause disease or be defective in another way.
Gene splicing - the process of cutting the DNA of a gene in order to add base pairs.
Gene targeting - the process of changing or turning off a particular gene.
Gene therapy - a method of treating a disease by exchanging the defective gene causing the disease with a healthy one in a cell.
Geneticist - a scientist who studies genes.
Gene transcription - the first step in gene expression where the genes DNA sequence is copied into messenger RNA.
Gene translation - the method where transcribed messenger RNA directs the making of proteins from amino acids.
Genetic code - all the genes a living thing has inherited. They determine appearance, function, growth, behavior, etc.
Genetic disease - a disease caused by a genetic mutation.
Genetic engineering - the technology used to genetically manipulate living cells to produce new chemicals or to perform new functions.
Genetic marker - a landmark that identifies a certain spot on a chromosome.
Genetics - the study of genes and heredity, or how characteristics are passed from parents to children.
Genetic testing or screening - a technique used to find out whether a person or organism has a particular gene.
Gnome - all the genetic information necessary to build a living organism. It is species-specific.
Germ cells - the cells that give rise to sperm or egg.
Genotype- The alleles present in an individual at the locus (loci) under consideration. Alternatively, the sum of all the alleles present in a genome.
Gene frequencies- The term used in population genetics for allele frequencies.
Genetic distance- various statistics for measuring the 'genetic distance' between subgroups or populations. Major distance measures include Nei's distance (1972, 1978), Reynold's distance (Reynolds et al. 1983) and new distance measures that incorporate the stepwise mutation process in microsatellites (RST of Slatkin 1995a, b; D of Shriver et al., delta mu of Goldstein et al. 1995).
Genetic drift- a force that reduces heterozygosity by the random loss of alleles. Drift is inversely related to population size. Infinitely large populations (an assumption of the Hardy-Weinberg equilibrium) will not experience drift, whereas small populations will experience major effects of drift. Drift is one of the major forces of evolutionary change (along with natural selection, mutation, genetic migration, and non-random mating). The equilibrium/balance between drift and mutation is a major focus of much of population genetics.Genetic markers- any trait used as a marker of genetic variation with in and among individuals and taxa. Traits used include phenotypic traits (eye color), protein products (allozymes, albumin), and segments of the DNA
Genetic swamping- the obliteration of local genetic variation by invasion or migration of individuals from another population. Often a concern in conservationGenome size: The genome is the collective term for all the complement of hereditary material found in an organism (e.g., all the DNA in the set of chromosomes in eukaryotes). Genome size ranges from approximately 104 base pairs (bp) in some viruses to approximately 1010 in many angiosperm plants, to > 1010 in some salamanders and fishes. Mammals have approximately 2-3 X 109 bp. Although polyploidy can increase genome size, most increase seems to be due to relatively small duplication events (because genome sizes within taxa tend to be approximately normally distributed around an intermediate modal size.
Genotype- The set of DNA variants found at one or more loci in an individual. The information from which genotypes are developed could include allozyme alleles, sequence information, or RFLP variants.
[-H-]
Haploid- having a single complement of chromosome.
Heredity - all of the traits passed on to children by parents (plant or animal) or the process of transferring these traits.
Heteromorphic chromosome pairs - chromosomes that visibly differ, like X and Y.
Heterosis/hybrid vigor - the superiority of hybrids.
Heterozygous - refers to having dissimilar alleles of one or more genes, as opposed to homozygous.
Homologous recombination - the process of replacing one DNA segment with a similar sequence.
Homozygous - refers to having an identical pair of alleles, one from each parent, as opposed to heterozygous.
Human Genome Project - a large project to map and sequence all DNA in human chromosomes.
Hybrid - a plant or animal that results from two different breeds or varieties of parents; carries two different genes for a characteristic.
Hybridization - the cross-fertilization or breeding of plants and animals to get the best.
Hybrid vigor/heterosis - the superiority of hybrids.
Hardy-Weinberg principle- (Hardy-Weinberg Equilibrium is abbreviated HWE) Given certain simplifying assumptions such as no genetic drift (= infinite population size), random mating, non-overlapping generations, no selection and no (genetic) migration, the genotype frequencies in an infinite population can be predicted from the gene frequencies, p and q by the formula:
p2 + 2pq + q2
A population will achieve Hardy-Weinberg equilibrium (HWE) in a single generation
(unless one of the assumptions listed above is violated). We test for HWE by
comparing observed and expected genotype frequencies. An amazing proportion
of the subject matter of population genetics is centered on how/why populations
deviate from HWE.
Heterosis- The hypothesis that multilocus heterozygosity will be associated with fitness or a fitness component.
Heterozygosity- An individual or population-level
parameter. The proportion of loci expected to be heterozygous in an individual
(ranging from 0 to 1.0).
HO (observed heterozygosity) is the observed proportion of heterozygotes, averaged
over loci.
HE (expected heterozygosity) is also known as gene diversity (= D; preferred,
less ambiguous term) and is calculated as 1.0 minus the sum of the squared gene
frequencies. [See Weir, 1996, p. 124 for the multi-locus, multi-allele formula].
Hypervariability- High degree of variation among individuals within local populations at a given genetic marker. Examples of hypervariable markers include minisatellites and microsatellites.
[-I-]
Inbreeding Coefficient- It is a measure of non-random association of alleles within an individual.
Inbreeding depression- reduced fitness due to increased homozygosity (therefore expression of recessive deleterious alleles) from inbreeding. Inbreeding depression is mostly a problem for large populations at drift-mutation equilibrium.
[-J-]
Jackknifing- A statistical procedure based on sequential omission of one item at a time from a data set, in order to estimate variances and confidence intervals from small samples. Bootstrapping performs much the same function, often better, and with the power of modern computers, jackknifing is less frequently used.
[-L-]
Linkage -An association in inheritance between traits, such that the parental trait combinations appear among the progeny more often than the non-parental. The proximity of two or more genetic markers (e.g. genes, RFLP markers) on a chromosome; the closer together the markers are, the lower the probability that they will be separated during DNA repair or replication processes (binary fission in prokaryotes, mitosis or meiosis in eukaryotes), and hence the greater the probability that they will be inherited together. Cf. recombination.Linkage disequilibrium- loci not in random association. The linkage disequilibrium parameter for a one-locus, two-allele model is given by D = P11P22 - P12P21. Dn = (1 - r)n D0, where r is the recombination frequency and n is the number of generations since D0. Speed of approach to linkage equilibrium depends on the magnitude of r. Decrease of linkage disequilibrium, d, is given by:
dg = (1-c)g * d0
where d0 is the starting level of disequilibrium, g is number of generations,
and c is the recombination rate (<= 0.5). [See Ayala, 1982, p. 138].
Locus- from the Latin for 'place'. A stretch of DNA at a particular place on a particular chromosome often used for a 'gene' in the broad sense, meaning a stretch of DNA being analyzed for variability (e.g., a microsatellite locus).
[-M-]
Mass selection - large-scale controlled breeding.
Maternal inheritance - the inheritance of a trait from the female gamete.
Meiosis - the process of cell division, where the number of chromosomes is reduced by half, then the new cells divide again by mitosis. Results in four daughter cells.
Messenger RNA (mRNA) - a single strand of RNA that directs protein production.
Metaphase - the second stage of mitosis during which the chromatid pairs align at the cells equator.
Mitochondria - the part of a cell that turns food into energy for chemical reactions, movement, and growth.
Mitosis - cell division resulting in daughter (new) cells that are genetically identical to each other and to the parent; the chromosomes are divided before the cell divides.
Molecular genetics - the study of molecules of DNA in order to identify the form and function of the genes in them.
Monohybrid cross - the graphing of only one trait in a Punnett Square, used for predicting heredity.
Multifactorial trait - a trait that is determined by heredity and environment.
Mutagens - substances which increase the likelihood of mutations.
Mutation - a permanent change in a DNA sequence that can be passed on. It can be a change in genetic information, addition of information, or deletion of information.
Maximum Likelihood:Maximum likelihood estimation (MLE) is a popular statistical method used to make inferences about parameters of the underlying probability distribution from a given data set.
Microsatellites- Short tandem repeats (e.g., ACn, where n > 8) of nucleotide sequences--the tandem units can be dinucleotides, trinucleotides or tetranucleotides
Migration- In population genetics, migration means the (permanent) movement of genes into or out of a population.
Minisatellites- [see VNTR]. Segments of repeated DNA often used as genetic markers for individual identification (forensic DNA 'fingerprinting') or analyses of relatedness. Can be either single- or multi-locus. Minisatellite technology relies on probe-based hybridization.
Morgan- a map unit for genomes, defined as that distance along which one crossing over is expected to occur per gamete per generation. In humans one centiMorgan is about 1,000 kb.
[-N-]
Null allele- allele that fails to become visualized under the analytical conditions (can happen with allozymes, microsatellites, et al.). See Pemberton et al. 1995 for discussion of the potential problem of homoplasy caused by null alleles.
[-O-]
OD- Optical density as measured in a photospectrometer. Used to assess the purity and concentration of DNA.Oligo(nucleotide)- short chain of nucleotides. Synthesized in the lab. as a starting point for developing primers, or for use as a probe.
Outbreeding depression (OD)- reduced fitness resulting from hybridization between divergent taxa. Intrinsic OD results from genetic incompatibility between the two taxa (e.g. chromosome differences that disrupt meiosis), whereas extrinsic OD results from reduced adaptive fit of the hybrid to the environment
Outcrossing - an inbreed crossed with a less related.
[-P-]
Phenotype - all the observable traits a person inherits, as opposed to the genome, or all the traits inherited.
Penetrance- the frequency with which an allele manifests itself (i.e., the proportion of the population that shows the influence of the allele).
Poisson distribution- a discrete distribution used to describe randomness in time or space. In calculating Ne (effective population size), the distribution of family sizes is expected to follow a Poisson distribution. By breeding so that family sizes are more even, one can make the effective size larger than the census size. A Poisson has the property that the mean equals the variance -- var > mean means clumped, var < mean means uniform.
Polymorphism: the presence of two or more variants of the DNA at a given locus. Often applied to variants of an expressed gene.
Population genetics - the study of how genetic principles apply to entire generations.
Primer- Short, preexisting single-stranded
polynucleotide chain to which new deoxyribonucleotides can be added by DNA polymerase
(to 'prime' PCR amplification). The primer anneals to a nucleic acid template
(DNA of the organism of interest) and promotes copying of the template, starting
from the primer site. To amplify microsatellites one uses a forward and reverse
primer pair:
[agctcagtccctagtcagtact]acacacacacacacacacacac[ggtacttcggagctatccgaattccct]
In this example the italicized bp are the forward and reverse primers (should
not differ among individuals), whereas the unitalicized 'ac' repeat is the microsatellite.
By running back and forth across the repeat one can amplify a few copies of
the microsatellite region by orders of magnitude, yielding sufficient DNA to
allow visualization of the amplified product on an acrylamide gel by staining
with ethidium bromide.
Some primer sequences may be conserved across wide taxonomic gaps (e.g., across
families), while others may differ even among congeners.
Private alleles: alleles found only in a single population. Used by Slatkin
(1985) to assess gene flow. Neel, J. V. 1973. Private genetic variants
and the frequency of mutation among South American Indians. Proc. National Acad.
Sci. USA 70: 33113315.
Probe- Single-stranded DNA or RNA molecules of specific base sequence, labeled either radioactively, immunologically, or by other means, that are used to detect the complementary base sequence by hybridization. Some genetic markers (e.g., minisatellites) depend on probe-based techniques.
Pseudogene-"A usually non-functional copy of a protein-coding gene inserted at another location in the genome. Most pseudogenes result from retroposition of processed mRNA's, and therefore typically lack introns and the regulatory sequences necessary for expression." [from Hillis et al. 1996] (See Paralogy)
[-Q-]
QTL- Quantitative Trait Loci. Molecular advances provide a relatively new opportunity to link quantitative genetics (which is largely phenotype-based) to its molecular basis. See Rieseberg et al. (2002) for an application of QTLs to the problem of whether speciation is driven largely by selection or drift.
[-R-]
Recombination- Exchange of gene segments by crossing over at chiasmata (exchange of material between non-sister chromatids). The exchanged sections are usually homologous. The likelihood of recombination increases with increasing physical distance. Cf. linkage.
RFLP (restriction fragment length polymorphism) - considered to be the most accurate DNA test; it takes several weeks to complete, and is becoming more frequently used in forensics cases.
[-S-]
Simple sequence tandem repeat- See microsatellite.
SNP- Single nucleotide polymorphism. In genome sequencing projects, attention is now often focusing on detection of single base-pair changes in the DNA sequence.
Structure2.1- Population Genetics software for assigning individuals to specific population , finding immingrants and admixture among population.
[-V-]
VNTR (variable number tandem repeat)- Segments of repeated DNA. Short base unit repeats (2-6 base pairs) are microsatellites, longer repeats (100s of bp) are minisatellites. The short length of the microsatellites (<= 300 bp) allows one to amplify the DNA with the PCR and is a key factor making microsatellites preferable to minisatellites (which require radioactively labeled probes).
[-W-]
Wahlund effect- Reduction in heterozygosity (increase in homozygosity) when distinct taxa are analyzed jointly. Whenever subpopulations vary in gene frequency, the population as a whole will show a Wahlund effect. The opposite effect, known as isolate breaking, occurs when divergent populations intermix. In that case, the interbreeds will show an increase in heterozygosity over the Hardy-Weinberg expectation.
[-X-]
X chromosome - one of the chromosomes that determines sex. Females have two X chromosomes in each somatic cell, and males have one X and one Y chromosome..
[-Y-]
Y chromosome - one of the chromosomes that determines sex. Males carry one X chromosome and one Y chromosome in each somatic cell.
Back to Main Page